|
CLS Cell Lines Service GmbH
ln229 cells ![]() Ln229 Cells, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc13108750-41-0-21?v=CLS+Cell+Lines+Service+GmbH Average 94 stars, based on 1 article reviews
ln229 cells - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Elabscience Biotechnology
ln229 cells ![]() Ln229 Cells, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc11483365-101-2-42?v=Elabscience+Biotechnology Average 93 stars, based on 1 article reviews
ln229 cells - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
GemPharmatech Co Ltd
ln229 cells ![]() Ln229 Cells, supplied by GemPharmatech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pm40083086-113-13-10?v=GemPharmatech+Co+Ltd Average 90 stars, based on 1 article reviews
ln229 cells - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
ln229 and t98g cells overexpressing cldn4 ![]() Ln229 And T98g Cells Overexpressing Cldn4, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc10326589-57-1-10?v=GenScript+corporation Average 90 stars, based on 1 article reviews
ln229 and t98g cells overexpressing cldn4 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
LGC Promochem
ln229 glioma cells ![]() Ln229 Glioma Cells, supplied by LGC Promochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc03195721-29-0-6?v=LGC+Promochem Average 90 stars, based on 1 article reviews
ln229 glioma cells - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
China Center for Type Culture Collection
ln229 cells ![]() Ln229 Cells, supplied by China Center for Type Culture Collection, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc10117932-58-20-29?v=China+Center+for+Type+Culture+Collection Average 90 stars, based on 1 article reviews
ln229 cells - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Harlan Laboratories
ln-229 glioblastoma cells stably expressing the mcherry fluorescent protein ![]() Ln 229 Glioblastoma Cells Stably Expressing The Mcherry Fluorescent Protein, supplied by Harlan Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/10__1074_slash_jbc__m114__633081-125-36-19?v=Harlan+Laboratories Average 90 stars, based on 1 article reviews
ln-229 glioblastoma cells stably expressing the mcherry fluorescent protein - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
aqp4-specific sirna plasmids for ln229 cells (insert: gctcaatagctttagcaattg and scrambled sequence inserted into pgpu6/gfp/neo) ![]() Aqp4 Specific Sirna Plasmids For Ln229 Cells (Insert: Gctcaatagctttagcaattg And Scrambled Sequence Inserted Into Pgpu6/Gfp/Neo), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pm21424125-16-0-16?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
aqp4-specific sirna plasmids for ln229 cells (insert: gctcaatagctttagcaattg and scrambled sequence inserted into pgpu6/gfp/neo) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
BioResource International Inc
green fluorescent protein (gfp)-labeled ln229 cells ![]() Green Fluorescent Protein (Gfp) Labeled Ln229 Cells, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc10212158-38-4-9?v=BioResource+International+Inc Average 90 stars, based on 1 article reviews
green fluorescent protein (gfp)-labeled ln229 cells - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Institute for Clinical Pharmacodynamics
glioma cell line u87mg p53si ![]() Glioma Cell Line U87mg P53si, supplied by Institute for Clinical Pharmacodynamics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pm16276348-20-20-69?v=Institute+for+Clinical+Pharmacodynamics Average 90 stars, based on 1 article reviews
glioma cell line u87mg p53si - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
JCRB Cell Bank
human glioblastoma cell line ln229 ![]() Human Glioblastoma Cell Line Ln229, supplied by JCRB Cell Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pmc06942437-52-23-32?v=JCRB+Cell+Bank Average 90 stars, based on 1 article reviews
human glioblastoma cell line ln229 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
iCell Gene Therapeutics
ln229 human gbm cell ![]() Ln229 Human Gbm Cell, supplied by iCell Gene Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ln229+cells/pm36064705-78-21-28?v=iCell+Gene+Therapeutics Average 90 stars, based on 1 article reviews
ln229 human gbm cell - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLOS One
Article Title: An optimized protocol for metabolic measurement in 3D tumor spheroids derived from primary and established glioblastoma cells
doi: 10.1371/journal.pone.0347569
Figure Lengend Snippet: A) Number of formed spheroids. Here, the number of single spheroids of roundish shape obtained per well for three tested methods used for the four glioblastoma cell lines and three different cell numbers is depicted. For BioFloat and magnetic bead technique all yields were equal to one and thus pooled. The 2D projected size is presented.(B, C). Graphs show the size of the formed spheroids as a function of time for the BioFloat (B) and magnetic bead (C) method. The circularity of the formed spheroids is shown as a function of time for the BioFloat (D) and magnetic bead (E) method. The relative height of spheroids for different techniques and all cell lines is presented (F). Error bars in B)-E) depict the standard error of the mean. Box plots in F) show the median (red line), the 25 and 75 percentile (blue box) and the maximal range (whiskers). Stars depict statistically significant results with p < 0.05. B) to E) For each cell line and cell number 16 spheroids were analyzed. F) n GBM10 Beads = 8, n GBM10 Biofloat = 8, n GBM4 Beads = 12, n GBM4 Biofloat = 9, n LN229 Beads = 11, n LN229 Biofloat = 8, n U138 Beads = 12, n U138 Biofloat = 8.
Article Snippet:
Techniques:
Journal: PLOS One
Article Title: An optimized protocol for metabolic measurement in 3D tumor spheroids derived from primary and established glioblastoma cells
doi: 10.1371/journal.pone.0347569
Figure Lengend Snippet: Seahorse analyses showing a comparison between metabolic values in the different glioblastoma cell lines LN229, U138 and the primary cells GBM#4, GBM#10. Representative mitochondrial respiration measurement using the Seahorse XF Cell Mito Stress Test for U138, LN229, GBM#4 and GBM#10 spheroids generated from 30,000 cells. Oligomycin, FCCP, rotenone plus antimycin A are used as pharmacological tools to study mitochondrial respiration. Oligomycin inhibits ATP synthase, reducing oxygen consumption. Rotenone and antimycin A block the electron transport chain, preventing mitochondrial respiration and allowing measurement of non-mitochondrial oxygen consumption. Oligomycin reduces the oxygen consumption rate (OCR) through inhibition of ATP synthase. FCCP uncouples the proton gradient, maximizing oxygen consumption. Rotenone and antimycin A are electron transport chain inhibitors.
Article Snippet:
Techniques: Comparison, Generated, Blocking Assay, Inhibition
Journal: PLOS One
Article Title: An optimized protocol for metabolic measurement in 3D tumor spheroids derived from primary and established glioblastoma cells
doi: 10.1371/journal.pone.0347569
Figure Lengend Snippet: (A) t-SNE clustering of spheroids from the four cell lines, showing the distinct response of LN229 compared to the other GBM cell types. Each point represents a single spheroid. Each point corresponds to the data of a single spheroid. (B) Illustration of the energetic state of the four GBM spheroid types at baseline and after FCCP injection to achieve maximal respiration. Error bars represent the standard error of the mean (SEM). The following number of spheroids was used for each group: n GBM10k = 42, n GBM4 = 44, n LN229 = 47, n U138 = 48.
Article Snippet:
Techniques: Injection
Journal: PLOS One
Article Title: An optimized protocol for metabolic measurement in 3D tumor spheroids derived from primary and established glioblastoma cells
doi: 10.1371/journal.pone.0347569
Figure Lengend Snippet: (A) Graphic of the raw basal respiration data obtained from the Seahorse metabolic analysis. The data were normalized using different approaches and are shown in (B) for median normalization, (C) for median plus area normalization, and (D) for median plus cell number normalization. Error bars represent the standard error of the mean (SEM). Asterisks indicate statistically significant differences at p < 0.05. The number of samples used in each group was as follows: n GBM10 15k = 13, n GBM10 20k = 16, n GBM10 25k = 13, n GBM4 15k = 12, n GBM4 20k = 15, n GBM4 25k = 17, n LN229 15k = 13, n LN229 20k = 14, n LN229 25k = 20, n U138 15k = 16, n U138 20k = 15, n U138 25k = 17.
Article Snippet:
Techniques:
Journal: PLOS One
Article Title: An optimized protocol for metabolic measurement in 3D tumor spheroids derived from primary and established glioblastoma cells
doi: 10.1371/journal.pone.0347569
Figure Lengend Snippet: Seahorse analyses showing the differences in the maximal respiration values of glioblastoma cell lines LN229, U138 and the primary cells GBM#4, GBM#10 after normalization of spheroids yielded from different cell seeding densities. (A) Graphic of the raw maximal respiration data obtained from the Seahorse metabolic analysis. The data were normalized using different approaches and are shown in (B) for median normalization, (C) for median plus area normalization, and (D) for median plus cell number normalization. Error bars represent the standard error of the mean (SEM). Asterisks indicate statistically significant differences at p < 0.05. The number of samples used in each group was as follows: n GBM10 15k = 13, n GBM10 20k = 16, n GBM10 25k = 13, n GBM4 15k = 12, n GBM4 20k = 15, n GBM4 25k = 17, n LN229 15k = 13, n LN229 20k = 14, n LN229 25k = 20, n U138 15k = 16, n U138 20k = 15, n U138 25k = 17.
Article Snippet:
Techniques:
Journal: Translational Cancer Research
Article Title: The LINC00957/miR-17-5p axis regulates the cell cycle and migration in glioblastoma via the cuproptosis-related gene nephronectin
doi: 10.21037/tcr-24-450
Figure Lengend Snippet: Knocking down NPNT enhances the sensitivity of glioma cells to cuproptosis inducers. (A) The CCK8 assay of U87 and LN229 cells treating with elesclomol. (B) The ROS levels of shNC or shNPNT U87 and LN229 cells treating with elesclomol and CuCl2. (C) The Copper concentration of shNC or shNPNT U87 and LN229 cells treating with different concentration of elesclomol (10 and 20 nM). Data were expressed as the mean ± standard deviation of three independent experiments (n=3). ns, not significant; ****, P<0.0001. IC 50 , half-maximal inhibitory concentration; ROS, reactive oxygen species; NPNT, nephronectin; CCK8, Cell Counting Kit-8; shNC, shRNA negative control; shNPNT, shRNA NPNT; shRNA, short hairpin RNA.
Article Snippet: U87 and
Techniques: CCK-8 Assay, Concentration Assay, Standard Deviation, Cell Counting, shRNA, Negative Control
Journal: Translational Cancer Research
Article Title: The LINC00957/miR-17-5p axis regulates the cell cycle and migration in glioblastoma via the cuproptosis-related gene nephronectin
doi: 10.21037/tcr-24-450
Figure Lengend Snippet: LncRNA LINC00957 and miR-17-5p can regulate NPNT protein in GBM tumors. (A) ROC curve of the AL365361.1, AL591848.3, LINC00957, and AF111167.2. (B) NPNT mRNA levels and AL365361.1, AL591848.3, LINC00957, and AF111167.2 in LN229 cells with ASO knockdown four potential lncRNAs was detected. Data were expressed as the mean ± standard deviation of three independent experiments (n=3). ns, not significant; ***, P<0.001; ****, P<0.0001. AUC, area under the curve; ASO, antisense oligonucleotide; NC, negative control; lncRNA, long non-coding RNA; NPNT, nephronectin; GBM, glioblastoma; ROC, receiver operating characteristic; mRNA, messenger RNA.
Article Snippet: U87 and
Techniques: Knockdown, Standard Deviation, Negative Control
Journal: Translational Cancer Research
Article Title: The LINC00957/miR-17-5p axis regulates the cell cycle and migration in glioblastoma via the cuproptosis-related gene nephronectin
doi: 10.21037/tcr-24-450
Figure Lengend Snippet: The LINC00957, miR-17-5p, and NPNT regulate the malignant progression of GBM. (A) The GO functional analysis of the related biological processes of DEGs in low expression group and high expression group among LINC00957 and NPNT. (B) The CCK8 results in U87 cells with knockdown of LINC00957 and NPNT. (C) The transwell results of crystal violet staining at 40× magnification in LN229 cells with knockdown of LINC00957. (D) The cell cycle results in LN229 cells with knockdown of NPNT. Data were expressed as the mean ± standard deviation of three independent experiments (n=3). ns, not significant; ****, P<0.0001. ASO, antisense oligonucleotide; NC, negative control; CCK8, Cell Counting Kit-8; OD450, optical density at 450 nm; shNC, shRNA negative control; shNPNT, shRNA NPNT; shRNA, short hairpin RNA; NPNT, nephronectin; GBM, glioblastoma; GO, gene ontology; DEG, differentially expressed gene.
Article Snippet: U87 and
Techniques: Functional Assay, Expressing, Knockdown, Staining, Standard Deviation, Negative Control, Cell Counting, shRNA
Journal: Translational Cancer Research
Article Title: The LINC00957/miR-17-5p axis regulates the cell cycle and migration in glioblastoma via the cuproptosis-related gene nephronectin
doi: 10.21037/tcr-24-450
Figure Lengend Snippet: The lncRNA LINC00957 and miR-17-5p can regulate NPNT protein in GBM tumors. (A) Correlation analysis between NPNT, LINC00957, and miR-17-5p. (B) The RNA levels of NPNT, LINC00957, and miR-17-5p in U87 and LN229 with ASO knockdown LINC00957 was detected; the RNA levels of NPNT, LINC00957 and miR-17-5p in U87 and LN229 treated with miR-17-5p mimic was detected; the RNA levels of NPNT, LINC00957, and miR-17-5p in U87 and LN229 treated with miR-17-5p inhibitor was detected. (C) Predicted binding site between LINC00957 and miR-17-5p. (D) Luciferase reporter gene test was used to test the relationship between LINC00957 and miR-17-5p treated with miR-17-5p mimic in U87 cell. (E) The CCK8 results in ASO NC or ASO LINC00957 U87 cells treated with shNC or shNPNT. Data were expressed as the mean ± standard deviation of three independent experiments (n=3). ns, not significant; ****, P<0.0001. NPNT, nephronectin; ASO, antisense oligonucleotide; NC, negative control; WT, wild-type; MUT, mutated; shNC, shRNA negative control; shNPNT, shRNA NPNT; shRNA, short hairpin RNA; lncRNA, long non-coding RNA; GBM, glioblastoma; CCK8, Cell Counting Kit-8.
Article Snippet: U87 and
Techniques: Knockdown, Binding Assay, Luciferase, Standard Deviation, Negative Control, shRNA, Cell Counting
Journal: American Journal of Cancer Research
Article Title: Claudin 4 enhances the malignancy of glioma cells via NNAT/Wnt signaling
doi:
Figure Lengend Snippet: CLND4 promotes malignancy in glioma cells. A. Expression levels (mRNA) of CLDN4 in normal tissues (n=5) and glioma tissues (n=156); data derived from TCGA database. B. Representative images of immunohistochemical staining for CLDN4 in para-carcinomatous tissues (n=15), early-stage glioma tissues (stage I-II, n=15), and late-stage glioma tissues (stage III-IV, n=15); scale bar =50 μm. C. Kaplan-Meier survival curve for high and low expression of CLDN4 in glioma patients (n=513); data from TCGA database. D. Western blotting for CLDN4 in LN229/T98G cells transfected with empty vector or a CLDN4-overexpression vector. E. Cell proliferation assay (CCK-8 assay) for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector. T98G, P<0.05, 72 hours; LN229, P<0.01, 72 hours. F. Cell migration assay (Transwell assay) for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector; scale bar =100 μm. G. Colony formation assay for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector.
Article Snippet: Transfected
Techniques: Expressing, Derivative Assay, Immunohistochemical staining, Staining, Western Blot, Transfection, Plasmid Preparation, Over Expression, Proliferation Assay, CCK-8 Assay, Cell Migration Assay, Transwell Assay, Colony Assay
Journal: American Journal of Cancer Research
Article Title: Claudin 4 enhances the malignancy of glioma cells via NNAT/Wnt signaling
doi:
Figure Lengend Snippet: CLDN4-stimulated NNAT upregulation. A. The top 30 upregulated genes in patients with gliomas that had high CLDN4 expression levels as compared to those with gliomas having low CLDN4 expression levels; data derived from TCGA database (n=513). B. Western blotting for CLDN4 and NNAT in LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector. C. Cell proliferation assays for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with scramble or NNAT siRNAs. LN229, vector vs vector + siRNA, P>0.05, OE vs OE + siRNA, P<0.05, 72 hours; T98G, vector vs vector + siRNA, P>0.05, OE vs OE + siRNA, P<0.01, 72 hours. D. Cell migration assay for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with scramble or NNAT siRNAs. E. Colony formation assays for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with scramble or NNAT siRNAs. F. Representative images of immunohistochemical staining for CLND4 in early-stage glioma tissues (stage I-II, n=15) and late-stage glioma tissues (stage III-IV, n=15); scale bar =100 μm.
Article Snippet: Transfected
Techniques: Expressing, Derivative Assay, Western Blot, Transfection, Plasmid Preparation, Over Expression, Cell Migration Assay, Immunohistochemical staining, Staining
Journal: American Journal of Cancer Research
Article Title: Claudin 4 enhances the malignancy of glioma cells via NNAT/Wnt signaling
doi:
Figure Lengend Snippet: The CLDN4/NNAT axis modulates glioma progression through Wnt signaling. (A and B) The results of the KEGG enrichment analysis for the major signaling pathways involved in glioma progression in 513 glioma patients divided into CLDN4-high/low (A) or NNAT-high/low (B) groups. (C) Western blotting for Wnt1, Wnt2, and Wnt3A in LN229 cells transfected with empty vector or CLDN4-overexpression vector. (D) Western blotting for Wnt3A in LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with scramble or NNAT siRNAs. (E) Cell proliferation assays for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with PBS or pyrvinium pamoate (10 nM). LN229, vector vs vector + PP, P>0.05, OE vs OE + PP, P<0.05, 72 hours; T98G, vector vs vector + PP, P>0.05, OE vs OE + PP, P<0.05, 72 hours. (F) Cell migration assays for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with PBS or pyrvinium pamoate (10 nM). (G) Colony formation assays for LN229/T98G cells transfected with empty vector or CLDN4-overexpression vector treated with PBS or pyrvinium pamoate (10 nM).
Article Snippet: Transfected
Techniques: Protein-Protein interactions, Western Blot, Transfection, Plasmid Preparation, Over Expression, Migration
Journal: American Journal of Cancer Research
Article Title: Claudin 4 enhances the malignancy of glioma cells via NNAT/Wnt signaling
doi:
Figure Lengend Snippet: CLDN4 facilitates glioma growth in vivo. A. Western blotting for CLDN4 in primary glioma cells derived from 6 patients. B. Representative images of PDOs derived from CLDN4-high and -low glioma tissues; scale bar =50 μm. C. Western blotting for Wnt3A and NNAT in PDOs derived from CLDN4-high and -low glioma tissues. D. Representative images for immunofluorescence staining for Ki67 in PDOs derived from CLDN4-high and -low glioma tissues; scale bar =50 μm. E. Tumor volumes of subcutaneous tumors formed by LN229 cells transfected with empty vector or CLDN4-overexpression vector (n=5 in each group). F. Kaplan-Meier survival curve for mice with tumors formed by LN229 cells transfected with empty vector or CLDN4-overexpression vector (n=5 in each group).
Article Snippet: Transfected
Techniques: In Vivo, Western Blot, Derivative Assay, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Over Expression
Journal: Radiation Oncology (London, England)
Article Title: Targeting α ν β 3 and α ν β 5 inhibits photon-induced hypermigration of malignant glioma cells
doi: 10.1186/1748-717X-6-132
Figure Lengend Snippet: Photon-induced stimulation of integrin expression . A: FACS analysis of α ν β 3 (upper row) and α ν β 5 (lower row) expression with (red) and without (black) photon irradiation with single doses of 2 Gy (left) and 10 Gy (right). B: Graphical analysis of integrin α ν β 3 (gray bars) and α ν β 5 (black bars) expression with (bars) and without (red line) irradiation with single photon doses of 2, 5, and 10 Gy in U87 (upper chart) and Ln229 (lower chart) glioma cells. Display of mean value ± standard deviation (SD); statistical analysis using Student's t -test (*, indicating significance p < 0.05)
Article Snippet:
Techniques: Expressing, Irradiation, Standard Deviation
Journal: Radiation Oncology (London, England)
Article Title: Targeting α ν β 3 and α ν β 5 inhibits photon-induced hypermigration of malignant glioma cells
doi: 10.1186/1748-717X-6-132
Figure Lengend Snippet: Inhibiton of Ln229 glioma cell migration by integrin inhibition . Quantitative analysis of Vn-based transmigration of Ln229 glioma cells following single photon doses of 0, 2, and 10 Gy without and with the addition of 50 ng/ml anti-α ν β 3 - and -α ν β 5 -antibodies and corresponding isotype controls. Display of mean value ± standard deviation (SD); statistical analysis using Student's t -test (*, indicating significance p < 0.05)
Article Snippet:
Techniques: Migration, Inhibition, Transmigration Assay, Standard Deviation
Journal: Frontiers in Oncology
Article Title: System analysis based on the migration- and invasion-related gene sets identifies the infiltration-related genes of glioma
doi: 10.3389/fonc.2023.1075716
Figure Lengend Snippet: EMP3 silencing attenuates the migration and invasion of glioma cells. (A) The expression of EMP3 in different cell lines in the CCLE datasets. (B–D) Western blot and qPCR display EMP3 express highly in U118 and A172. (E–G) The growth curve and plate cloning experiment display that EMP3 silencing has little effect on the cell proliferation of U118 and A172. (H, I) EMP3 knockdown inhibits the migration and invasion of glioma cells. ( J–O , 20×) qPCR displays EMP3 silencing attenuates the expression of MMP2 and MMP9 expression (ns, p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).
Article Snippet: The normal human astroglia (NHA), which were purchased from the Chongqing Golden Magpie Technology Development Co., and U251, LN229, A172,
Techniques: Migration, Expressing, Western Blot, Cloning, Knockdown
Journal: Frontiers in Oncology
Article Title: System analysis based on the migration- and invasion-related gene sets identifies the infiltration-related genes of glioma
doi: 10.3389/fonc.2023.1075716
Figure Lengend Snippet: EMP3 silencing suppressed EMT marker expression. (A) Western blot analysis of U118 transfected with indicated siRNAs targeting EMP3 (siEMP3#1, siEMP3#2, and siEMP3#3) or siNC. (B) Western blot analysis of A172 transfected with indicated siRNAs targeting EMP3 (siEMP3#1, siEMP3#2, and siEMP3#3) or siNC. (p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001).
Article Snippet: The normal human astroglia (NHA), which were purchased from the Chongqing Golden Magpie Technology Development Co., and U251, LN229, A172,
Techniques: Marker, Expressing, Western Blot, Transfection
Journal: PLOS ONE
Article Title: Tetra- O -methyl-nordihydroguaiaretic acid inhibits energy metabolism and synergistically induces anticancer effects with temozolomide on LN229 glioblastoma tumors implanted in mice while preventing obesity in normal mice that consume high-fat diets
doi: 10.1371/journal.pone.0285536
Figure Lengend Snippet: (A) Effects of combination treatment of M 4 N with TMZ on tumor growth in nu/nu mice implanted with glioblastoma LN229 cells. LN229 xenograft mice (N = 5/group) were treated with or without M 4 N by daily oral administration for 35 days. Meanwhile, another set of LN229 xenograft mice (N = 5/group) were treated with TMZ only or M 4 N+TMZ by daily oral administration for 25 days, and the examination of tumor growth was continued even after the termination of drug treatments. The tumor volumes of M 4 N, TMZ, and M 4 N+TMZ groups were significantly different compared to the control group after day 23 (*p<0.05). The bars indicate standard deviations. (B-C) The effects of combination treatments of M 4 N with sorafenib on the survival rates of nu/nu mice (N = 5) implanted with various tumors were examined (A-B). Drugs were administered daily via intravenous tail vein injection (B-C). (B) AsPC-1 pancreatic tumors. (C) HepG2 hepatic tumors. (D) Effect of combination treatments of M 4 N with etoposide, rapamycin, or UCN-01 on HL-1 mouse heart cells. Cell death was examined by the Trypan blue exclusion assay in HL-1 cells treated with combination treatments for 24 h. The concentrations of M 4 N are shown in the figure. The concentrations of etoposide, rapamycin, and UCN-01 were 10, 20, and 5 μM.
Article Snippet: Green fluorescent protein (GFP)-labeled
Techniques: Injection, Trypan Blue Exclusion Assay
Journal: PLOS ONE
Article Title: Tetra- O -methyl-nordihydroguaiaretic acid inhibits energy metabolism and synergistically induces anticancer effects with temozolomide on LN229 glioblastoma tumors implanted in mice while preventing obesity in normal mice that consume high-fat diets
doi: 10.1371/journal.pone.0285536
Figure Lengend Snippet: (A) The box figures show the amounts of metabolites in the treated tumors on an arbitrary scale. The upper edge of each box represents a limit of the upper quartile, whereas the lower edge represents a limit of the lower quartile. The line in the middle of each box represents a median value. Asterisks show that the difference between the LN229 tumors treated with TMZ (T) alone and those with TMZ+M 4 N (TM) were statistically significant by the Student’s t -test (*p<0.05, **p<0.02, ***p<0.01, and ****p<0.1). Sharp marks show that the difference between the LN229 tumors treated with vehicle alone and either those with TMZ (T) alone or those with TM were statistically significant by the Student’s t -test (##p<0.01). The amounts of lactate, α-ketoglutarate, fumarate, and malate were smaller in the TM than T group (indicated by blue downward arrows). Right inlet figure: TM combination treatments suppressed the expression of LDHA in LN229 tumors transplanted in xenograft mice. Lower right inlet figure: M 4 N suppressed the O 2 consumption of LN229 cells. LN229 cells were treated with M 4 N (30 μM) for 24 h. O 2 consumption, which is an indicator of the activity of mitochondrial oxidative phosphorylation, was measured by an O 2 consumption rate assay kit (Cayman Chemicals, Ann Arbor, MI, USA). When the concentration of O 2 is lower, the intensity of the fluorescence becomes stronger. The bars in the figure indicate the standard deviations. There were statistically significant differences between the control and M 4 N-treated cells at all the time points later than 10 min by the Student’s t -test (p<0.05). (B) Effect of M 4 N (M) and/or T on the intracellular contents of NAD + , nicotinamide, and FAD. The data points are from the tumors of five mice. One asterisk (*) indicates that there was a significant difference between either control and T, or control and TM by the Student’s t -test (p<1%), whereas one sharp mark (#) indicates that there was a significant difference between T and TM by the Student’s t -test (p<5%). The upper edge of each box represents a limit of the upper quartile, whereas the lower edge represents a limit of the lower quartile. The line in the middle of each box represents a median value. (C) Effect of M and/or T on the expression of NAMPT. (D) Schematic showing the effect of the combination treatment of TM on the mechanisms of NAD + synthesis. See for metabolite abbreviations.
Article Snippet: Green fluorescent protein (GFP)-labeled
Techniques: Expressing, Activity Assay, Concentration Assay, Fluorescence
Journal: PLOS ONE
Article Title: Tetra- O -methyl-nordihydroguaiaretic acid inhibits energy metabolism and synergistically induces anticancer effects with temozolomide on LN229 glioblastoma tumors implanted in mice while preventing obesity in normal mice that consume high-fat diets
doi: 10.1371/journal.pone.0285536
Figure Lengend Snippet: (A) Left panel: M 4 N+TMZ (TM) combination treatment synergistically reduced the viability of cultured LN229 cells. LN229 cells were treated with M 4 N (M) and/or TMZ (T) at the concentrations indicated in the figure. Cell viability was examined by the MTT assay at 72 h after treatment. The bars indicate standard deviations (N = 8). Right panel: A combination index (CI) plot obtained by the CompuSyn software for the experiment shown in the left panel. A CI less than 1.0 indicates that there is a synergy between two drugs. (B) M or TM combination treatment reduced HIF1A contents in cultured LN229 cells. LN229 cells were treated with M (40 μM) and/or T (30 μM) in the presence or absence of 50 or 150 μM CoCl 2 , which mimics hypoxic conditions. The cells were collected at 16 h after the treatment and the contents of HIF1A were examined by Western blotting. β-actin was used as a control. The arrows indicate the bands for HIF1A and β-actin. Control–vehicle only (C), M, T, and TM. (C) M 4 N treatment induces the rapid degradation of HIF1A in cultured HeLa cervical cancer cells during moderate and intermittent hypoxia. HeLa cells were exposed to either moderate hypoxia (4.0% O 2 ) for 10 h or intermittent hypoxia (see Materials and Methods) for 7 h in the presence or absence of 60 μM M 4 N, and HIF1A protein levels were determined by Western blot analysis ( Ca ). The extent of HIF1A protein loss due to PHD-dependent proteasome-mediated degradation was ascertained by co-treatment of the cells with DFO (150 μM) ( Ca ). β-actin was used as a control ( Ca ). Levels of HIF1A mRNA were assessed by Northern blot analysis ( Cb ). The blot was re-probed with a β-actin cDNA probe to control for gel loading and transfer ( Cb ).
Article Snippet: Green fluorescent protein (GFP)-labeled
Techniques: Cell Culture, MTT Assay, Software, Western Blot, Northern Blot
Journal: PLOS ONE
Article Title: Tetra- O -methyl-nordihydroguaiaretic acid inhibits energy metabolism and synergistically induces anticancer effects with temozolomide on LN229 glioblastoma tumors implanted in mice while preventing obesity in normal mice that consume high-fat diets
doi: 10.1371/journal.pone.0285536
Figure Lengend Snippet: (A) Two stress-related proteins, ATF4 and CHAC1, were induced in LN229 tumors implanted in nu/nu mice treated orally with M 4 N (M) and TMZ (T) for 25 days. The proteins were detected by Western blotting. (B) TMZ+M 4 N (TM) combination treatment synergistically induced the production of superoxide in cultured LN229 cells. The superoxide assay using MitoROS 580 dyes was performed in LN229 cells treated with M (40 μM) and/or T (30 μM) for 2, 4, 24, or 48 h. Control—vehicle only (C), M, T, or TM. The bars indicate standard deviations (N = 8). Asterisks show that the difference between the control and the LN229 tumors treated with M, T, or TM were statistically significant by the Student’s t -test (*p<0.05, **p<0.01, and ***p<0.001).
Article Snippet: Green fluorescent protein (GFP)-labeled
Techniques: Western Blot, Cell Culture
Journal: PLOS ONE
Article Title: Tetra- O -methyl-nordihydroguaiaretic acid inhibits energy metabolism and synergistically induces anticancer effects with temozolomide on LN229 glioblastoma tumors implanted in mice while preventing obesity in normal mice that consume high-fat diets
doi: 10.1371/journal.pone.0285536
Figure Lengend Snippet: The box figures showed the amounts of metabolites in the tumors (which included both LN229 cancer cells and their associated cells such as macrophages infiltrated in the tumors) treated with drug on an arbitrary scale. The difference in amount of 2-hydroxyglutarate (2-HE) between the tumors treated with TMZ (T) alone and those with TMZ+M 4 N (TM) was statistically significant by the Student’s t -test (**p<0.05). The difference in amount of itaconate between the control and the tumor treated with M 4 N (M) was statistically significant by the Student’s t -test (***p<0.01). The data points are from tumors of five mice. The upper edge of each box represents a limit of the upper quartile, whereas the lower edge represents a limit of the lower quartile. The line in the middle of each box represents a median value. The green downward arrows indicate that the contents in lactate, α-ketoglutarate, and LDHA were reduced by TM, compared with T alone. The red upward arrows indicate that the content of itaconate was increased by M, compared with the control or that the content of pyruvate was increased by T alone and TM than the control. Itaconate was produced from macrophage-related cells only (indicated by the designation ‘macrophage’), whereas 2-HE and lactate were produced by any cells including LN229 cells (indicated by the designation ‘LN229’). See for enzyme abbreviations.
Article Snippet: Green fluorescent protein (GFP)-labeled
Techniques: Produced